circad | circRNAs associated with diseases

cZNF292
Gene	ZNF292	Organism	Human
Genome Locus	chr6:87920168-87928449:+	Build	hg19
Disease	Heart failure	ICD-10	Congestive heart failure (I50.0)
DBLink	Link to database	PMID	27613831
Experimental Method
Sample Type	U87MG and U251 Cell lines	Comparison	human glioma U87MG and U251 cell lines
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCTCAAGAGACTGGGGTGTG Reverse AGTGTGTGTTCTGGGGCAAG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Yang, P, Qiu, Z, Jiang, Y, Dong, L, Yang, W, Gu, C, Li, G, Zhu, Y (2016). Silencing of cZNF292 circular RNA suppresses human glioma tube formation via the Wnt/펲-catenin signaling pathway. Oncotarget, 7, 39:63449-63455.